Nästa Landvetter

Malteskorset är på och nu kör vi!
 
Nu är jag typ klar med packningen eller typ och typ jag är klar, ska la bara fixa lite med passet och det!
Idag har jag hunnit med mycket, har till och med varit ute och sprungit en runda, så underbart kan jag säga!
Är superduper taggad nu, jag och Emelie ska försöka blogga där nere om vi har tillgång till data och internet.
Hinner inte skirva så mycket mer, måste hinna leka lite med molly och så.
-Love Erica

Hejdå Sverige ♥

Godmorgon!:) 
Nu är nästan allt färdigpackat det är bara lite grejer som ska ner i handbagaget. Jag vägde min stora resväska innan som bara får väga max 20 kilo och gissa vad den vägde? Jo, 40 kilo. Fick lite smått panik där ett tag.. men sen insåg vi att det var fel på vågen så jag klarade mig som tur va:D 
Nu är bara den stora frågan vad jag ska ha på mig? Måste ha mina träningssockar på flygplanet och det blir liiite bökigt att få under dom under mina tighta jeans, folk kommer ju undra vad det är för fel på mig?! haha.. det får jag leva med..
Nu måste jag göra mina rehabövningar också-.-
Kommer inte blogga nåt mer nu innan vi åker men förhoppningsvis hittar vi någon dator vi kan uppdatera ifrån. 
Ha det bästa hemma i kalla gråa regniga Sverige, fast nu skiner ju faktiskt solen;) 
Ta hand om varandra och sköt om er själva! 
Puss och Kram
-Emelie 
     ♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥
 
Piece and Love

I'll love you mom

 
Äntligen har jag NÄSTAN packat klart, är så sjukt trött och det är mamma med kan jag säga.
Det har varit mycket skratt under packningen och så dålig humor vi har...
Nu ska jag faktiskt ta och sova, Godnatt SVERIGE!
-Love Erica

Det är bara regn hos mig

Jag och Jessica fick springa in och ut i bilen i stan idag, det regnar ju HELA TIDEN, beroende av vädret är vi också, vi har gäspat konstant hela vägen in till Borås, i Borås och påväg hem från Borås. Lite mysigt hade vi det iaf när vi satt inne på Café Bakgården och fikade :) Sedan hann vi även med en snabb tur inne i stan och jag fick med mig en vit kavaj och en klänning hem som ska med till Malta :) 
 
Nu blir det tacosmys med la familia och Anita, sen kommer Erica hit en stund och säger hejdå (var ju tänkt att jag, Erica, Erica och Stina skulle träffas och säga hejdå, men blir nog inte så...) sen ska jag fortsätta packa.. bloggar nog en gång till ikväll:)
puss på er
-Emelie 

I'll be standing right next to you

 
 
Hejsan och förlåt för dålig uppdatering från min sida men det är jätte jobbigt när man inte kan blogga från mobilen.. Men har iallafall varit i Göteborg idag och köpt lite grejer in i det sista och börjar nog på lite resfeber nu och är super stressad och trött och allt. För det första så har jag typ inte packat något förutom bikini och för det andra har jag lovat att kolla på Rebeccas match i spöregn och för det trejde gick jag upp 20 över 7 idag och drog till tandläkaren wihoo....
Men kanske hör av mig ikväll annars blir det förhoppningsvis ett snabbinlägg imorgon innan vi drar till Landvetter!
-Love ericaaaa
  

springer springer upp och springer springer ner

 
 
 
Hej på er!:) 
vill börja med att säga att jag blir så  förbannad när hela skiten fuckar upp sig och allt försvinner precis när jag ska trycka på publicera!!!
 
Kvällen igår blev riktigt lyckad, det var god mat och trevligt sällskap såklart:D Efter vi hade vart hos Erica Andren hämta vi upp Erica Sandgren (många Ericor) som följde med mig hem. Hon tyckte inte att min gröt som jag måste äta som frukost såg speciellt god ut haha, vilket den inte är heller.. Har även gjort mina dödstråkiga rehabövningar, ska försöka få med Erica att göra dom i Malta och antingen blir det så att hon är med eller så kommer hon ligga bredvid mig på golvet och bara peppa mig: tre två ett bra emelie nu kör vi på nästa övning, haha. Imorgon går planet till Stockholm och sedan vidare till Malta på onsdagmorgon, ska bli skönt att få lite värme och sol på sig:D tror jag behöver det faktiskt.
 
Har tillägnat morgonen till att springa upp och ner i trapporna och packat, packat och packat,
Jag hatar att packa.
Men än sålänge går det ganska bra, alla kläder jag har tagit fram har fått plats i resväskan och den väger inte för mycket.. än. Har mer än hälften kvar på checklistan som jag inte har packat ner än..
 
Det blir fullt upp idag, ska packa klart, göra iordning mig och åkte in till stan med Jessica och kanske Erica, sen ska vi träffas några och säga hejdå..
-Emelie 

Myskväll med familjen svensson


Nytt från Gina Tricot

Har glömt att visa vad jag fick med mig hem när jag och Erica vad i stan senast:
 
 
Får väl säga att packningen går si sådär, hatar att packa.. Nu ska jag iväg till tränaren igen och hämta mina ilägg till skorna och sen fixa iordning mig lite tills ikväll då vi ska till Erica!
-love Emelie 
 
 

Äta träna sova

Hej!:)
Åkte till min såkallade tränare igår och svimmade där, så när jag kom hem fick jag äta och bara ligga och vila och fick inte blogga eftersom jag fick mobilförbud och dataförbud för honom, för det kunde bli värre då(?). Vi har iallafall äntligen fått reda på vad det var som orsakade min benhinneinflammation.
 
Fick gå upp ganska tidigt idag för jag skulle upp och äta frukost och göra min träning och sedan åka till honom igen. Och nu är jag hemma! Känns som att det ända jag får göra är att äta, träna och sova, kan han glömma!
 
 
Det är så mycket lättare att bara lägga in lite inlägg från mobilen då och då än att sitta och överföra massa bilder till datan och sen blogga, hoppas blogg.se löser det snart..
jaja, Jag ska börja packa nu och så får vi se om Erica S kommer hit en stund när hon kommit hem från Falkenberg!:) 
vi hörs sen!:) 
-Emelie 

When the sky is falling down-

 
Godmorgon, det passar verkligen in med "god" idag. Gjorde världens godaste och nyttigaste smothie!
Den bestod av:
- 1 Banan
- 1dl hallon
- 1dl blåbär
- 4st jordgubbar
- 4msk Turkiskyoghurt
- lite linfrön & solrosfrön på toppen och avslutas med en jordgubbe
 
Kan verkligen rekomendera detta, och man blir verkligen mätt på det.
Vad händer idag för min del?
Idag så ser mina planer ut såhär:
-Ut och springa
-Duscha
-Hälsa på mormor
-Packa inför MALTAAA
-Goa Emelie med familj kommer hit, så ska vi grilla och ha det mys!
Så ser min dag ut än så länge men vi får se hur den egentligen blir, men ska lyssna klart och sjunga klart min och klaudias 24/7 låt nu LOOOVEEE
-Love Erica

Trött Erica & trött Molly


Midsommar 2012

Shit vilken midommar kan jag börja med, vi var överallt och det var fest överallt och det kunde nästan inte bli bättre kväll!   Det började med att vi satte oss på tåget och var nästan säkra på att vi skulle dra till Falkenberg eftersom alla andra våra vänner var där, men under tiden fick vi lite meddelande av olika och då bestämmde vi oss för att dra till Halmstad istället. När vi kom dit så mötte vi upp några på grandhotell och satt uppe hos dom en bra stund och dom alla var ju så duktiga på att spela gitarr och sjunga så det fick vi med höra, såå sjukt bra lät det och love it! Sen spran vi på några kompisar från U-hamn och va lite med dom och gick runt men sen skulle dom åt ett håll och vi åt ett annat så för oss bar det av till Östrastanden där det blev party i en stuga med härligt folk och mycket dans!! p.s Klaudia var GALLLEEEN men det är så det ska va på dansgolvet! Sen bar det av till Centrum där vi skulle träffa ett gött gäng och så träffade allt möjligt folk från dagen och Bulls avslutade våran midsommar med mycket dans och en glad Jonas haha sötis! Det negativa med dagen var att vi sov i en bil.. sov och sov gjorde vi inte men väntade tills tåget skulle gå kl 9:00 på modognen och det var lite kallt mn det gick bra och nu är jag emma och har duschat och sittter med lite te vid datorn och väntar på att Emelie ska höra av sig. Ska nnog ta ooch ringa Matilda och fråga hur hon har det i Vietnamn, det har bara gått en vecka utan henne nu... 4 veckor kvar..                                                                                                                           -Love Erica
 
 
 
 

om 22 juni och 23 juni

Hejsan!:) 
Det går ju somsagt inte blogga från mobilen så det blir lite dålig uppdatering tyvärr..
 
Igår började jag dagen med en springtur, sen fick jag dricka en ny sportdryck jag har fått. 
 
Jag hade fortfarande svårt att bestämma mig om jag skulle följa med Erica och Klaudia men det blev att jag stannade hemma tillslut eftersom mamma och allihopa ville träffa mig innan jag åker till Malta och jag ska till min tränare idag, och hade jag följt med dom visste vi inte vilket tid vi skulle komma hem osv..
 
Medans mer än hälften av svergies befolkning ligger bakfulla idag ska jag träna och tagga inför Maaaaaaaaaalta beach! Tror jag ska börja packa lite också, göra en lista på vad jag behöver ha med mig och så:) 
 
Hoppas ni mår bra idag :) 
-Emelie 

New in

-Love Erica

Tröttaaa

åh så irriterqad jag är på blogg.se just nu... eller iaf på mobilen det har inte kunnat blogga från mobil på hela dagen, tror att dom gör om där med eftersom att dom har ändrat till den nya här på datorn nu. Får se om vi fattar detta helt tillslut men jaja!
Idag så har vi varit i stan och jag fick med mig puder, mascara och solglasögon ´hem och är super nöjd! Vi åt också frukost på resturange peking SUSHI OCH THAIMAT!!
Sen blev det smothie på viskan mums....
Emelie kom till mig vid 11:40 och då var jag i underkläder och hade precis kommit ut från duschen och hade 20 minuter på mig till bussen men det hann jag allt!
Nu ligger vi trött i soffan och somnar närsom..
Hör av oss sen!
-Erica & Emelie
 

Elitidrottare nästa?

Hola amigos! Visst låter det som att Erica har haft det helt underbart i Falkenberg? :D

Jag var somsagt och sprang innan och precis när jag kom ut från det stora varvet in till lilla varvet igen så ringer mamma och säger att hon kommer och hämtar mig nu för vi skulle till en person som var duktig på dehär med benhinnor, eftersom att jag har problem med mina, så jag fick springa som en idiot hem så vi kunde åka till honom.
Han är tydligen elitcyklist och tränare eller har hand om det svenska skidlandslaget eller något sådant, så man fattar ju att han är grym på sin grej. När vi kom dit fick jag dricka någon drink med vitaminer och proteiner och aminosyror och allt vad det var i den och den var faktiskt riktigt god så den skulle jag kunna tänka mig att fortsätta dricka faktiskt. Så fick jag någon annan påse med pulver i med jordgubbssmak som inte alls är god, jag måste dricka upp den nu men funderar på att hälla ut den i smyg
Sen mätte han runt om mina ben när jag spände och slappnade av, tryckte på olika punkter, vener och muskler så det gjorde så förbannat ont, ah han fortsatte med massa grejer och det visade sig att jag är helt sne och konstig.. haha!
Fick även ett par sockar som typ spänner åt på musklerna så man får blodcirkulation i benen och det är kviksilver och grejer i dom så jag får absolut inte vika dom när jag har på mig dom för då kan det gå riktigt illa och jag kan få blodstopp..
Han säger att vi ska bygga massa muskler på mig så att jag blir stark men inte biffig så därför ska han fixa matschema och träningsschema som jag ska följa, träningsschemat låter helt okej för min del faktiskt :D Elitidrottare nästa? Jag ska dit imorgon igen, får se vad han hittar på för något då
Nu ska jag försöka få i mig den här drickan och sätta på en film:)
-Emelie

I give anything but l'll never give you up





Halli alla solstrålar!
Hoppas ni alla mår bra i det underbara fina vädret det gör iallafall jag, har precis varit ute och sprungit i 1 och 1/2 timma så underbart kan jag säga det bara rinner från pannan och har också gjort några sit-ups men ska göra minst hundra idag så ska fortsätta nu efter jag bloggat klart!
Ska träna hela veckan nu, har aldrig ätit så mycket som jag gjort dem senaste tre dagarna, så sjukt illa mår jag när jag tänker på det men kan ju säga att det var gott för stunden och ibland får man faktiskt gotta till sig lite!
Jaja nu ska jag berätta lite om igår och idag:

Igår då så började det med att vi gick upp och åt en super god frukost med ägg och bara pratade, sen tog vi en promenad ner till stranden och kände på vattnet och gick några till kilometer. en när vi kom tillbaka till husvagnen så tog vi våra grejer och gick till toaletten och duschade och sminkade oss inför utgång på stan.
Haha provade allt jag hade med mig och kunde verkligen inte bestämma mig vad jag skulle ha för vi visste ju inte hur kvällen skulle sluta, men tog på mig min virkade tröja och svarta jeans eftersom att det blåste och skulle bli lite kallare till kvällen, får inte glömma att jag också hade på mig min high heals (orange:a) och så begav vi oss till stan. Och får inte glömma att berätta att vi gick in till stan, det var ca 5 kilometer in och det gick superbra på dit vägen, inte så mycket klag då. Sen när vi var framme i stan så gick vi till Harrys och åt en helt underbar middag och mätta blev vi med, sen flyttade vi oss till Harrys soffa och beställde in varsin efterrätt och kaffe på det. Vi hade ett par goa killar som satt i soffan jämte som snackade lite med oss och vi fick oss några skratt där med! Sen när vi var klara där så började vi gå mot bryggan som var 5 kilometer tillbaka och då kände jag att fötterna var lite trött och började fippla lite men det var bara kul! På vägen till bryggan hände det massa, det var ett gäng killar som skulle ta kort på oss med min telefon också, så sa jag att han inte fick ta den och så roligt tyckte han det var och drog till med ett skämt: haha ne det ser ju inte ut som ni skulle kunna springa efter direkt haha så jäkla klockrent var det. ah och lite kissepauser fick det med bli under resan till bryggan.
Sen när vi var framme vid bryggan så satt vi där och bara njöt av havslukten och solnedgången ( åh saknar det)
Vi begav oss senare till en lite badhytt inte vilken badhytt som helst, utan den jag hyrde förra midsommar haha så många roliga minnen har jag där ifrån, men detta året var det ett supergott tjejgäng som hyrde stugan. Så vi satt där med dom och skrattade, sjöng, dansade, och lärde känna varandra lite mer.. Tack för en super kväll!
Sen drog jag och Stina hem till husvagnen och la oss och frös ihjäl typ men det gick bra det med!

Nu över till denna dagen. Det började med samma som igår med go frukost fast mycket goda jordgubbar och banan. Sen gick vi och sminkade oss och packade sedan ihop våra grejer, eller jag packade ner allt mitt och Stina tog bara med sig lite eftersom hon åker tillbaka till Falkenberg imorgon. Men iallafall så åkte vi till varberg vid 11 tiden kanske? trött var jag iallafall, för lite shopping. Var ute efter en midsommar klänning, skor och puder och jag fick tag på allt utom pudret såå surt, men det är lätt att köpa här hemma sen.
Klänningnen och skorna kommer bild på imorgon.
13:44 gick tåget från varberg till Kinna så skulle vi ta buss hem sen!
Vi var hemma lite innan 16:00 och blev att lämna mina grejer hos Stina för att sedan gå vidare till körskola grejen som jag trodde var i 4timmar men den var bara i 3 timmar så sjukt glad blev jag iallafall!
Sen har jag inte gjort så mycket mer förutom att varit ute och sprungit och  sprang också förbi Emelie för att tänkte att vi skulle planera midsommar än, helt sjuk vi vet inte hur vi ska göra, får snacka ihop oss med klådii med och bestämma oss snart. Stackars Emelie var dock inte hemma för hon var och tittade sina ben för hon hade ont i dom, hoppas det blir bättre gumman! Nu ska jag äta en banan och ta lite te och sedan ta en kall dusch och bädda ner mig i sängen med en go film och verkligen sova ut!

-Love Erica

Talk is cheap just do it

Hello finisar!:) Allt bra?
Jag blev nöjd med håret för en gångs skull, fixade utväxten och gjorde lite mer slingor.
Vad har jag gjort annars idag? solat, gjort lite ärenden med mamma och städat ur min garderob i rummet, hittade hur många par skor och väskor som helst "man vet inte vad man har förens man har städat" helt enkelt..
Nu ska jag ut och springa det långa varvet i skogen (y)
-Emelie
#inspiration #Iwantthisbody

Bläää

Mår illa, är trött, darrar allt är perfekt verkligen och nu ska jag sitta på bilkurs i 4 timmar, hoppas jag klarar mig!!
Berättar om dagarna i falkenberg ikväll!
-love Erica


Godmorgon:)

Hej! Är ganska avundsjuk på alla personer som är vid kusten nu i det underbara vädret faktiskt, själv har jag legat ute och solat på altanen en stund och nu ska jag börja fixa mig för jag ska vara hos frisören om tjugo minuter:)
Hoppas ni får en bra dag
-Love Emelie


Harrys levererar med god mat som vanligt!



Nu har vi precis ätit upp den goda maten och nu ska vi sitta här och skratta med trevligt sällskap och sedan blir det kaffe!
-love Erica

Alllllll in tonight!


Finns det någon, som kan leda mig fram Ge mig själ till att tro att min dröm kan bli sann

Hej på er!:)
Tog en springtur i det fina vädret, kände att jag behövde lite frisk luft och rensa tankarna. Det känns som att det är mycket som pågår uppe i mitt huvud nu.. Det här med Malta och att jag kommer sakna många osv, men det beror nog på att jag är trött efter DH också kan jag tänka mig.

Nu tänkte jag göra några situps och tagga inför Sverige matchen ikväll, dock spelar det ingen roll om dom vinner eller inte, dom är ju ändå ute, men det är alltid kul att titta på :)
-big love Emelie

 


@ kapten röd

Hallåhallå! Kom hem klockan halv åtta i morse från Jönköping. Jag gick och la mig direkt när jag kom hem och vaknade nu. Ska gå ner och äta frukost och duscha, efter det får vi se vad dagen har att erbjuda, är inte den piggaste personen idag direkt, men det är värt de för Kapten Röd var så jäkla grym igår! Fick platserna längst fram i mitten, kan det bli bättre?:D
Idag är det en vecka kvar tills vi åker till Stockholm och imorgon är det en vecka kvar tills vi lämnar landet.
woopwoop
-love Emlie

Godmorgon

Fryst jävel inatt men inga sura miner för det, nu sitter jag och äter glass lite innan frukosten MUMS!
Vädret ser för övrigt bra ut idag så nu taggar vi jävel!!! Wihoo
-love Erica


Campinglivet


Vi har det bra i regnet!

Hello, nu ligger jag och Stina i sängen och värmer oss, det är lite kallt och spöregnar lite till och från.
Men det gör ingenting för att imorgon ska det bli fint väder och då ska vi sola och bada och senare på kvällen drar vi nog in till stan och kollar vad som erbjuds där. Vad vi ska göra ikväll vet jag inte, nu har det precis slutat regna men tror att vi bara tar det lugnt och pratar lite och bara har det allmänt mysigt!
-Love Erica

Nu drar vi till falkenberg!



wiiihooooo nu drar jag och Stinis till Falkenberg!
Dom har precis hämtat mig och nu sitter vi och sjunger och taggar i bilen!
Mamma kom och väckte mig halv 1 idag då fick jag verkligen stressa jävel, hade varken packat eller tänk vad jag skulle ha med mig men jag klarade det och fick med mig det viktigaste!
Ne nu ska jag tagga vidare, hör av mig sen!
-Love Erica

A true love story never ends.

 



Godkväll allesammans, eller är det kanske time to say goodnight?

Jag har iallafall lagt mig i sängen efter en lugn dag som började med att ligga i soffan helt slut och kolla på top model, det gick repris från ett gamalt så det var bara att kolla timme efter timme.
Sen tog jag en lång och varm dusch och sedan drog jag upp till Emelie för att hämta moppen som har stått där några dagar... Jag vill så gärna ha körkort snart det hade verkligen varit pricken över i:et, men den dagen kommer när den kommer!
Sen när jag kom hem så kom Stina hit och hämtade sin cykel (James) haha, vi snackade lite och as garvade, fast skrattet blev enormt mycket mer senare under dagen hahah!
Sen hämtade vi även Syrran som varit i Rhodos 1 vecka så skönt att ha henne hemma så jag äntligen få ha dom snygga kläderna som hon tog med sig det är la det negativa med en syster som delar kläder! Fast ändå sjukt bra när hon köper något nytt snygg!
Haha gud vad jag tjatar och ögonen går typ i kors, det betyder ju att jag slår på min depp musik och somnar gott till den inatt och taggar morgon dagen!
TAGGGATAGGGATTAAAAGGGGAA! (Berättar imorgon vad jag ska göra)

-True love Erica

Godnatt :)

Nu lägger jag mig, läser Zlatan boken och taggar inför kapten röd imorgon!
Taggar även för att gå upp klockan halv sex, yes de är värt det!:)

Godnatt godingar!:)
Kram Emelie

Bilden kommer från första sidan ur Zlatan boken.


Godaste frukosten

-love Erica


Cozystyle

Godmorgon sötnosar!
Hoppas ni får en bra söndag allihopa!:)
-Love Emelie


DH

Gokväll!:)
Jag och Erica har tillbringat dagen i Jönköping på DH. Vi hann precis till invigningen (y) det var sjukt mycket folk, bloggare och artister bl.a. Sean Banan;)
Nu sitter vi på bussen och ska åka hem och sova!:)
-Emelie


100% cozy

Har grillat lite och nu sitter jag och Stina och myser med lite gotti!
-love Erica


Chacha alfie här

Tjenare blooggen , tyyppp dremhacken här softilerar med emelie och hennes blondtfriend(eri-fika) och alla boysen!
doftar axen lixom dah, bloggen halllååååååååååååå Alfred Jäderland is in the here softilerar å filosoferar byebloken
DREAMHACK hare gytt in-tehouyse . bye bloggen minns mig <3

why is it so much easier to forgive a stanger than someone you love.






Godmorgon alla söta!

Hur mår ni idag? Jag mår super bra och har fått sova ut också så underbart!
Idag har jag inget planerat faktiskt, tror jag ska träna lite så jag kommer i form till Malta!
Om 11 dagar är jag om Emelie på Malta och solar och badar jävel!!!! Fy vad vi är taggade det är sjukt!
Frågan är när man ska hinna packa, det är helt fullproppat med grejer jag ska göra nu innan vi åker..

Gårdagen tillbringades med Emelie med massa mys och så sminkade hon mig lite snyggt som vi skulle lagt upp här egentligen men vi fick lite bråttom så det blev inte som planerat!
Sen åt vi lite pizza och skrattade, sen åkte jag, Emelie och Klådii till Kinna för nya äventyr haha att vi alltid kan göra det tråkiga till superduper roligt!
1 2 3 fanta och rose! haha så grymma är vi.
David och Sebbe kom sen och chillade lite med oss på scenen.

Det är sjukt vad tiden går fort, vi har redan haft sommarlov i över en vecka och det känns som typ 2 dagar...
-Love Erica

Day 3: Eight things that annoy you.

 falska personer
 lögner
 tjuriga tanter/gubbar
 vissa poliser
 folk som tror att dom är äldre än dom är
 smala personer som försöker banta -.-
 folk som tar saker föregivet
 när folk KLAGAR

Nu har älskade Mattis lämnat Sverige 5 veckor framåt, får se hur jag kommer klara mig! Love you bästi!!<3


Galen hund

Har precis kommit hem till Erica. Och Molly är helt galen så ska leta upp ett koppel och gå ut med henne sen hoppas jag att Erica kommer hem;)
-Emelie


Lång promenad

Hej allesammans hoppas ni gillar videoklippet från balder haha fan vad kul!
Nu är jag ute och går en jätte lång promenad med Molly och hon är redan trött så fick bli ett stopp vid en sten för att vila lite! Men nu ska vi fortsätta gå!
-love Erica


uppdateringen om Liseberg

Hellu!:)
Det blev dålig uppdatering igår för vi fick så brottom att göra iordning oss när vi väl hade bestämt att vi skulle följa med till Liseberg. Erica somna på mig i bilen påvägen dit, standard ;)
Vi lyckades nog pricka in den sämsta dagen att åka på för det var skitmycket folk och svin kallt så jag fick springa och köpa mig en snygg lisebergs tröja ;)
Balder är ju helt klart skönast att åka, och så var vi tvugna att åka atmosfear eftersom att Erica inte hade åkt den än, fyfan!!
Erica som var ett vattendjur i sitt förra liv (skämt o sido) älskar att åka alla blöta banor så dom drog hon med mig i, så kalla, trötta och blöta gick vi ut från Liseberg.
Vi träffade även Anton, Tim och Jesper som vi åkte lite med och ingen mindre än Björn Rosenström var där och uppträdde.
Vi filmade sista åket i Balder, acceptera att jag låter som en kråka, och min hals är tyvärr inte bättre idag..
Nu ska jag städa mitt rum, sen ta en lååååång varm dusch.
-love Emelie


Liseberg levererar


Beslutsångest

Goooooodmorgon!:)
Ligger i sängen och pratar med Erica och vi försöker bestämma om vi ska åka till Liseberg eller inte.

Kvällen igår var bra förövrigt, fötterna är helt ömma efter all dans i klackarna, så de ska va!:)

Nu måste vi bestämma hur vi ska göra, vi hörs sen!:)
-Emelie

https://cdn2.cdnme.se/cdn/8-1/3142116/images/2012/pic_206586614.jpg" class="image">

https://cdn2.cdnme.se/cdn/8-1/3142116/images/2012/pic_206586620.jpg" class="image">

https://cdn2.cdnme.se/cdn/8-1/3142116/images/2012/pic_206586629.jpg" class="image">


Gårdagens outfit!

-love erica


Student

-love Erica


Day 2: Nine things you do everyday

♥ ÄTER
♥ borstar tänderna
♥ sover
♥ Pratar
♥ Säger äckel
♥ Pratar med Mattis
♥ Sitter
♥ Bloggar
♥ Smsar

Godmorgon, idag har jag hunnit vara hos Tandläkaren och spänt sen gick jag hem och hämtade molly och va ute med henne i det fina vädret! Samma som Musse så sprang Molly runt och jagade skalbaggar haha och åt upp en fjäril med. Nu ligger vi i soffan och halvsover, men måste snart börja göra mig iordning till studenten och jag har ingen aning vad jag ska ha på mig på studenten eller ikväll......
-Love Erica

Day 2: Nine things you do everyday

♥ ÄTER
♥ borstar tänderna
♥ sover
♥ Pratar
♥ Säger äckel
♥ Pratar med Mattis
♥ Sitter
♥ Bloggar
♥ Smsar

Godmorgon, idag har jag hunnit vara hos Tandläkaren och spänt sen gick jag hem och hämtade molly och va ute med henne i det fina vädret! Samma som Musse så sprang Molly runt och jagade skalbaggar haha och åt upp en fjäril med. Nu ligger vi i soffan och halvsover, men måste snart börja göra mig iordning till studenten och jag har ingen aning vad jag ska ha på mig på studenten eller ikväll......
-Love Erica

Pollenallergi?? Eller hur...

Hej!:)
Har precis varit hos doktorn och det var ingen pollenallergi-.- det är bara en kraftig förkylning och magkatarr..

Just nu sitter jag på trappan i det fina vädret och kollar på när Musse jagar skalbaggar. Så söt! Det är kul att det går bra för Erica mer Molly också!:D

Ikväll blir det nog fest för min del också, men måste tänka på att ta de lugnt nu för det är ju inte långt kvar tills jag och Erica flyger till Malta. SÅ TAGGAD!
-Love Emelie


Tough times never last, but tough people do.



Godkväll alla söta!
Nu har jag precis kommit hem från en spring och kvällspromenad, så skönt var det!
Nu är jag så trött så kommer la inte hinna sätta på en film innan jag somnar, eller så får jag ta och letta upp  One Three Hill då lär jag inte somna LOVE IT.
Fast funderar på att ställa mig i duschen nu också men tror det blir imorgon istället för om jag somnar med blött hår så ser det kaos ut..
Imorgon väntar Student för Henke och senare på kvällen blir det party! WIHOOO

Juste min dag idag har jag inte berättat om, åkte in till stan kl 2 med brudarna och så gick vi och åt på viskan ah eller jag åt en ceasarsallad och som fikade lite gott! Sen gick vi runt i stan och jag försökte hitta en snygg sommarfest klänning men det gick ju inte jätte bra eftersom att Molly var med så fick bära runt på henne och hon knälde så jag fick la vara ute med henne för det mesta!
Aja som sagt somnar snart så får gå och ta av sminket och borsta tänderna!
Love & Peace
-Erica

Dagens outfit: Stickad go tröja och svarta byxor!

Kvällspromenad med Molly!


Day 1: Ten random facts about yourself.

♥ Jag brukar alltid låsa toalettdörren även om jag är ensam hemma
♥ Det går inte en dag utan att jag pratar med Mattis
♥ Tycker ibland om att ligga i sängen och lyssna på depplåtar och gråta lite
♥ Älskar att lära mig spela nya låtar på piano och sjunga till
♥ Minns vad jag drömmer varje natt
♥ Gillar att träffa nytt folk
♥ Är svag för bruna ögon, grrr
♥ Är rädd för att glida ifrån mina nära vänner
♥ Jag tror på ÖDET och ANDAR (vet att det finns)
♥ Tycker det är kul att ta på fiskar! 
 
-Love Erica

Don't expect too much, it's always better to feel surprised than to feel disappointed

Hej på er!:)
Tar min andra promenad för idag, jag mamma och Maja ska sätta oss nere på Kinarestaurangen och äta lite:)

Och jag svär på att det inte är någon pollenallergi jag har så ska ner till läkaren imorgon igen och kolla mig, hoppas jag får penicillin eller något som kan ta bort viruset nuuuuu..
Hörs sen/Emelie

 

 


NEW SHOES


Här har ni bild på mina nya skor, I Love Them and it's a nice summer color!
-Love Erica
 

When the moon is gone.



Godmorgon sunshines!
Mamma väckte mig innan hon åkte och med henne kom Molly som somnade så gott i min säng till världens bästa musik och sällskap!
Sen gick vi ut en sväng och gud så söt hon är när hon springer så glatt mot än, fast hon är alltid lika söt tycker jag!
Nu sitter jag med en god frukost och planerar in dagen. Blir att åka in till stan och gå runt där en stund, sen vet ja inte hur min dag ser ut mer faktiskt men hör av mig sen!
-Love Erica

@frukost


DOMARJÄVEL!!!!

Har blivit mycket fotboll idag. Först åkte vi upp och kollade på när Lukas spelade match, de vann med 8-2 bra jobbat grabbar!
Sen satt hela familjen bänkade i soffan och kollade på Sverige- Ukraina.. Okej Ukraina spelade bättre men Åååh vad dom filmade och domarna måste köpts...
Vi håller bara tummarna för att de går bättre nästa matcher!

Har fått en nattkompis idag också, lille Musse! Nu sitter han jämte mig och skäller för att han inte vågar hoppa ner från soffan, sötis:')
Har ni haft en bra kväll?:)
-love Emelie


GOOOOO SVERIGEEE

HELT UPPSPELTA ÄR VI NU EFTER TACOS OCH BEN&JERRY OCH HEJAR SOM BARA DEN PÅ SVERIGE!
GOOOO FOR IT!
-LOVE ERICA



Läkarbesök & fotboll

Hej alla fina läsare!:)
Det var ingen lunginflammation som tur var, det är pollenallergi istället, rätt sjukt att man kan bli sån av pollen?.. Nu har jag iallafall fått medicin och grejer så vi hoppas på det bästa, att det går över snart.
Rätt som det var höll jag på att svimma där inne, kände hur varm och konstig jag blev inne i de rummet, så förklarade han att jag MÅSTE äta och dricka mer än vad jag gör och så gav han mig lite tips för mina benhinnor också.

Just nu sitter jag i soffan med feber och tittar på MTV :)
Ni glömmer väl inte att Sverige spelar i EM idag?:)
Jag och Mamma som faktiskt inte brukar kolla på fotboll har redan sett tre matcher och det är faktiskt roligt, ge det en chans, många snygga killar också ju ;)
-Emelie


Morgon promenad!


In order to get what you want you have to know what you deserve.

Godmorgon!:)
Jag känner mig inte alls bra, hostar och låter som en kråka. Mamma ringde till doktorn och dom skulle ringa tillbaka så tror jag ska gå ner och kolla mig så det inte är lunginflammation igen, bra start på sommarlovet:(

Jag gjorde ett te på ingefära och citron innan, (egentligen skulle det vara vitlök i också men de skulle jag aldrig kunna dricka.) så la jag i lite honung också för de ska ju vara bra mot halsen även fast det inte är speciellt gott.. Och det var inte téet heller, det är säkert nyttigt och bra men det gick inte att dricka.. Så aldrig mer!

Hoppas ni mår bra iallafall:)
-Emelie


Ten days!

Day 1: Ten random facts about yourself.
Day 2: Nine things you do everyday.
Day 3: Eight things that annoy you.
Day 4: Seven places you like to shop at.
Day 5: Six songs that you’re addicted to.
Day 6: Five things you can’t live without.
Day 7: Four memories you won’t forget.
Day 8: Three words you can’t go a day without using.
Day 9: Two things you wish you could do.
Day 10: One person you can trust.


Så nu ska jag ägna mig åt detta i 10 dagar med! Ska bli kul!
-love Erica


Can you blow my

Godkväll alla läsare!
Molly är verkligen världens mysigaste och det är så gulligt när hon går efter min hela tiden och bara viftar på den lilla svansen. Nu sover hon så gott efter allt kliande på magen!
Och det ska nog jag med göra snart, håller på att kolla på askungen och nu håller mössen på att göra hennes klänning!
Hoppas ni får en go natt! Puss!
-love Erica


VÄLKOMMEN TILL FAMILJEN ÄLSKADE MOLLY






Dance in the rain!

Blir en tripp med mamma mot gekås, ska kolla om one three hill säsong 9 har kommit och 90210 säsong 3!
Sen ska vi hälsa på mormor också! Ikväll får jag se vad som händer!
-love Erica


Love

-Emelie


när man inte vet vad man ska skriva och allt bli gaaadhsjadh

Hejsan!:)
Vaknade klockan halv ett idag, riktigt skönt att sova ut:D
Jag har gått och blivit sjuk också, perfekt till sommarlovet eller vad säger ni? 
Jag känner på mig att den här sommaren kommer bli riktigt bra, om vädret vill vara med oss så att säga, just nu spöregnar det ute..
Ska gå och byta om nu och sätta ny tejp på min mage.. har tappat min kula till piercingen (igen)... så smart!
Sen ska jag bara vänta på att Erica kommer till Svenljunga så ska jag träffa henne en stund:)
Ha det bra:)
-Emelie

GODMORGON

Kan inte fatta att det är sommarlov, helt sjukt! Allt börjar närma sig,
Midsommar: 13 dagar
Stockholm: 16 dagar
Malta: 17 dagar
Birthday: 64 dagar
Synd att jag & Emelie missar p&l, vi får nog det grymt kul i Malta med wihoo!
Nu blir det god frukost och säga hejdå till Rebecca som åker till Rhodos på studentresa!
-love Erica


Prom 2012





Balen 2012


Time for skolavslutning

-såå jävla glad!!!
-love Erica


Morgonen

Hej!:D Fick en stund över nu så jag bloggar lite:)
Jag fick gå upp jättetidigt idag för att fixa Maja med smink och hår, så söter blev hon:)
Har även hunnit fixa iordning mig själv och vart fotograf:)
Nu har alla gått till Kyrkan för att kolla på Lukas och Majas skolavslutning och jag sitter och äter halstabletter, målar naglarna och lyssnar på musik (y)
Erica kommer hit om en liten stund och då beger vi oss till skolan för att städa ur mitt skåp och lämna in nyckeln, sen måste vi hem igen för jag ska sminka henne!:)
Just nu skiner solen lite också, hoppas det håller i sig tills ikväll!!:D
-Emelie 

GRATTIS TILL STUDENTEN

godkväll, kan ju börja med att dagen har varit grym, att den inte kunde bli bättre.
Att få se så många lyckliga studeter gör verkligen en glad, jag är såååå sugen med, längtar ihjäl mig..
Jaja imorgon har ju jag bal så får nöja mig med det, tiden kommer gå så fort så måste ta vara på tiden.
Jag vet inte vad jag vill göra efter skolan än, men kommer säkert plugga vidare och starta något eget skulle jag tro!
Nu ska jag gå och lägga mig, behöver en sköhetssömn. Ska försöka blogga imorgon kan bli lite stressigt men ska försöka. 
- Love Erica 

GRATTIS TILL STUDENTEN VÄRLDENS BÄSTA,  FINASTE, VACKRASTE SYSTER! LOVE YOU<3 









New in closet


Som ni vet var jag på student i Göteborg idag:) Hann med att åka in till stan en stund också, detta är vad jag köpte + ett par svarta byxor, och de sista grejerna inför imorgon som ni inte får se nu;)
Och här har ni en bild på Matilda, gick inte att rotera bilden eftersom min data inte vill samarbeta..
Erica ringer mig om en liten stund och efter jag har pratat med henne ska jag hoppa in i duschen och sen ta en kopp té och hoppas på att de lindrar min hals.
Är så sjukt taggad för imorgon:D dock förbereder jag er på att det blir en dålig uppdatering..
Ha det gött!:)
-Emelie

next: Student för kära syster!

-Love Erica

Ibland är det skönt att va galen

Just nu känns det som att allting kommer bli perfekt till fredag. Håret, sminket, klänningen, allt!
Idag har det bjudits på mycket skratt, inte så konstigt när man umgås med galna brudar, haha!:)

Nu har jag fått as ont i halsen medans alla andra börja bli friska, hoppas det inte håller i sig bara...
Imorgon blir det student"fest" i Gbg, och åka in en sväng till stan I think.
Synd att det är svinkallt ute annars kunde jag haft min nya klänning på mig imorgon, men får gå och leta upp något annat jag kan ha på mig..
Pusshej Emelie

 

 


@stan


Just take it day by day

Nu beger jag mig mot Erica och Hanna för att se hur jag kanske ska bli iordning gjord till balen på fredag, Felicia kommer nämligen dit och ska provsminka mig och fixa håret!:) blir kul:)
Pusshej
-Emelie


Ta vara på tiden för någon dag kommer det vara försent



Morgon alla!
Att jag alltid ska frysa om mina fötter, får börja använda mina tofflor kanske! Känner min väldigt glad när jag ser färgen lila och det har jag ingen förklaring till, älskar verkligen lila men har inte så mycket av det. Självklart så fick det bli en lila vitamindryck idag och kolla på min fina blomma!
Nu ska jag börja fixa mig och se vad dagen har att erbjuda.
-love Erica


You are my last mistake!



Godkväll, eller god och god vet jag inte..
Känns verkligen inte som en bra dag idag.. allt har bara gått skit men man måste ha dåliga dagar för att veta vilka dagar som är bra.
Jag och Mattis var iallafall och kollade på balen innan och dom var så fina men det började verkligen pissregna så det var tråkigt menmen.
Sen kollade jag på 90210 men missace halva för han inte komma hem men det får jag kolla på datorn eller något!
Det var också sista avsnittet av Desperate Housewifes idag också, vill verkligen inte att det ska ta slut men jag tror att någon vacker dag kommer det komma en till säsong och allt kan hända.
Imorgon är det Sveriges Nationaldag med och då får jag se vad som händer.
Nu ska jag fortsätta lyssna på depp musik och skriva med Mattis!
Juste håller på att bli frisk med WIIHOOOO :D
-Love Erica

Prom number 3

-love Erica

https://cdn3.cdnme.se/cdn/8-1/3142116/images/2012/pic_205472403.jpg" class="image">


Some people are so poor, all they have is money

Hej på er!:)
Har precis sprungit hem från Erica, riktigt skönt!:)
Har inte gjort något i skolan förutom kollat på talangjakten och uppträtt med våran egna låt klassen har gjort:)

Våran underbara lärare Pernilla hade med sig fika till oss på Biologi lektionen så vi satte ihop massa bänkar och hade lite cozytime tillsammans. Sista gången vi träffar henne och riktigt pratar osv så det blev många tårar i slutet då hon sa att hon kommer sakna oss och att hon tycker om oss väldigt mycket..:'(
Jag kollade lite på när Erica och Stina övade i kyrkan till fredagen, och sen gick vi tre hem till Erica:)

Erica har åkt i väg till Borås och jag ska gå och duscha och sen göra slingor på Mammi:)
-Love Emelie

 

 


Ge aldrig upp en kamp, du kan inte vända så fort vägen blir brant

Hej finisar!:)
Ikväll har jag hunnit med en go kvällspromenad med Kola och vart en snabbis på Ica med mamma:)
Har inte gjort något annat speciellt, precis ätit kvällsmat(bilden) och gjort iordning mig för sängen!:)
Imorgon väntas det talangjakt i skolan, ska bli kul:)
Godnatt & sov gott!:)
-Emelie

 


Bilderna hörs till inlägget nedan


Hot food

Äntligen är maten beställd!
Ska bli så gott med thaimat nu och jag tog det starkaste och hoppas på att känna smaken, vill bli frisk nu!
-love Erica


Happy birthday mami

Grattis världens bästa mamma!

Idag fyller värdens bästa år och det ska firas!
Jag mamma och Johan ska nog ut och äta ikväll och det ska bli väldigt mysig och
jag hoppas att mina smaklökar har vaknat till liv då med.. är så förskyld orkar verkligen inte det men ah..
Duhar fått allt nerskrivet och du vet hur mycket du betyder för mig, helt underbar är du.
Jag älskar dig gosi!
pussss din
Erica





Fler bilder @ spex

Lånade från Stina :) 

Spexxxx, Muckdagen


My own Angel, Mattis I love you my best friend. Forever and ever

I'm pretty sure the whole "ladies first" thing was created by a guy just wanted to check out ass.



suddigt
Snygga linnen bakifrån

Muckdagen 2012

Ska försöka få tag i lite mer bilder från dom som gick runt med sina kameror hela tiden
Som ni ser är jag utklädd till en tönt/nörd men de tyckte jag liknade Britney Spears i videon: Baby on more time.
Jajja, sen man började sjuan har man sett fram till muckdagen, dock var det inget speciellt förutom att (nästan) alla var utklädda till något och vi fick ta muckfoton, spexfoton som de flesta kallar det. Det hade nog vart lite roligare om det var varmt och soligt så man kunde vara ute och ta massa kort osv, istället fick vi frysa oss igenom den här dagen också.
Sluta tidigare fick vi också göra eftersom att det inte finns något att göra i skolan längre :D
Detta var sista måndagen för oss i Mogaskolan då, lite sorgligt att tänka så faktiskt, men det ska bara bli skönt att sluta:)
Grattis Doris som fyller år idag också:D:D
-Emelie

Godnatt

-Love Erica


LITE TIPS FRÅN ERICA


Mixa lite med brunt och rosa och få en mycket fin sminkning.
1. Börja lite lätt med brunt på ögonlocket länste ner längst med ögat
2. Lite starkare brunt längt bort på ögonlocket och lite högre upp
3. Ta det rosa och börja längst in på ögonlocket och dra diagonalt uppåt
4. Starakre desto längre ut du kommer
5. Walla en enkel och fin sminkning till både vardag och Fest

Denna sminkning tycker jag skulle passa till dessa Odd Molly tröjorna


Men också till denna snygga festklänningen till dom dundersnygga skorna!




som man bäddar får man ligga!

                                    

Halli alla söta!
Hur är det med er? Jag mår la inte jätte bra, har råkat ut för förskyldning eller ont i halsen mest. Igår kunde jag inte prata jag var hes som vet inte vad..
Idag har jag städat hela mitt rum, till och med min Garderob och det behövdes verkligen.
Vet inte om jag är förskyld i näsan eller inte, jag nyser och nyser men kan vara dammet i mitt rum och pollen så det återstår att se!
Imorgon händer det mycket:
-Världens bästa mamma fyller år
- Muckdagen
Det är två stora saker och jag hoppas hon blir nöjd över presenterna och dagen.
Ni får se imorgon vad jag klär ut mig till så kommer tyvärr inte säga det här och nu.
Jaja men nu ska jag ta en duscha och dricka 20000 koppar te och bara ta det lugnt!
-Love Erica

I feel my heart start beating to my favourite song

Godmorgon Godmorgon Godmorgon!:)
Blev lite dålig uppdatering igår, men var ute och sprang och fick världens allergichock, HATAR POLLEN!!!
Sen fixade jag mig och drog till Erica där Matilda redan var, och sen kom de andra tjejerna också:)
Vi satt och pratade hur länge som helst och försökte bestämma vad vi skulle hitta på och runt elva ringer vi till Jessica och frågar om hon kan köra mig, Matilda, Klaudia och Erica till en fest i Månstad. Så det blev ännu en lyckad kväll:) Taaack Jessica, du är guld värd!<3
Nu har jag kommit hem från Erica och ska börja städa mitt rum som ser ut som ett K-R-I-G... sen kommer Sandgren hit!:)
Lite sommargrejer jag köpte, blir as snyggt om man använder snygga smycken och detaljer till ;)
+ ett par vita jeans och en mascara.

Borås

Hejsan! Det har varit en bra dag i stan idag.
Först drog vi till Nelly, men hittade typ ingenting, ville ju köpa skor men fanns nästan inga snygga.. Får åka in nån annan dag när dom har fått in lite nya saker:)
Sen gick vi in till stan och träffade Julia en liten stund och gick och kollade lite mer i affärer:)
Ska alldeles strax gå och duscha och fixa mig för kvällen:)
Ni får bilder på vad jag köpte sen.
-Emelie
(bild på Magribe)


Livet är kort, men ändå det längsta man någonsin kommer att ha




Nu drar jag till stan för att fixa mina naglar, vet inte om jag ska göra likadana som förra gången eller körs på något nytt!
Nu får jag springa iväg till bussen!
-love Erica


Saturday morning

Om en stund åker jag till Borås ska in till Nelly och kolla om det finns några snygga skor:D
Take care/Emelie


When you wish all just was a dream

Godkväll sunshines!

 Har precis lagt mig i sängen nu och måste bara säga: JÄVLAR vad ont jag har i halsen..... fan jag orkar inte med att bli sjuk nu faktiskt.. har ni några bra tips för att lindra halsont? Jag vet bara att man ska:
-äta hounung eller dricka med te
-vitlök?
haha det var allt jag kom på för tillfället? sjukt jobbigt iallafall, min röst kommer säkert att försvinna med, inte alls kul faktiskt.. Imorgon ska jag upp ganska tidigt för att åka till stan och fixa naglarna igen så dom är fina till balen. Hoppashoppashoppas att vädret blir bra och att det absolut inte regnar. Imorgon kväll får jag se vad som händer, men ska nog tillbringa kvällen med Mattis, Emelie och Stina vad jag vet så det låter toppen! Godnatt och hoppas ni sover gott!
-Love Erica

Prom

-Sven Eriksson
-love Erica


1 juni

Godmorgon!:)
Om en liten stund åker jag och pappa och levererar trädgårdsmöbler och efter det ska vi åka och hämta Erica!:)
Oj måste åka nu, puss och kram!:)
-Emelie

https://cdn3.cdnme.se/cdn/8-1/3142116/images/2012/pic_204862485.jpg" class="image">


RSS 2.0